lizzy127
lizzy127 lizzy127
  • 05-05-2018
  • English
contestada

Which of the following would be the most reliable source of information for research?

Which of the following would be the most reliable source of information for research class=

Respuesta :

jthomas8 jthomas8
  • 05-05-2018
an organization website
Answer Link
idkkxx33 idkkxx33
  • 05-05-2018
an organization website bc all of the others would not be reliable
Answer Link

Otras preguntas

what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
How has water influenced the development of civilization in Africa
when Jefferson took office he did what