MiritaraoJaToria0ha4
MiritaraoJaToria0ha4 MiritaraoJaToria0ha4
  • 03-01-2016
  • Chemistry
contestada

Which group on the Periodic Table has
elements with atoms that tend not to bond with
atoms of other elements?
(1) Group 1 (3) Group 17
(2) Group 2 (4) Group 18

Respuesta :

Billymkhoi
Billymkhoi Billymkhoi
  • 04-01-2016
The answer is (4) Group 18, where the noble gases are. As we all know, noble gases already have 8 valence electrons, so they don't react and thus tend not to bond with atoms of other elements.
Hope this helps~
Answer Link
alexak
alexak alexak
  • 04-01-2016
Group 18 on the Periodic Table has elements with atoms that tend not to bond with atoms of other elements.

Answer: (4) Group 18
Answer Link

Otras preguntas

what is the range of motion of the elbow if extension is 0° and flexion is 145°?
Which excerpt from Beowulf best supports the answer to Part A?
please help i’ll give brainlist :)
Use the figure below. What is m
What causes the different seasons on Earth? O A. The angles at which the suns rays strike the Earth O B. Increasing levels of carbon dioxide in the atmosphere.
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
if f(x) = 3x² tlo, what is f(-7)?
What is the frequency of light with a wavelength equal to 500 nm? Hint 1 nm 10-9 m
budget deficit singapore for 5 year
The water level in Lisa's fish tank drops 1/3 of an inch every 10 minutes. What is the change in the water level after 1 hour?