Seudónimo Seudónimo
  • 03-10-2015
  • Mathematics
contestada

4.5ft is what circumference of a circle

Respuesta :

BlackWidow000
BlackWidow000 BlackWidow000
  • 03-10-2015
Formula for the circumference of a circle is
1). 2 • 3.14 (pi) • r
Or
2) d • 3.14
In this case I'm using #1
Plug in the numbers

2 • 3.14 • 4.5= 28.26
Answer Link

Otras preguntas

How might the actions of the Iranian government promote the activities of groups like Jundallah?
There are 15 rolls of film in a box and 3 are defective. Two rolls are to be selected, one after the other. What is the probability of selecting a defective rol
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
ANSWER IS NOT A PLEASE HELP
On April 2, Kelvin sold $80,000 of inventory items on credit with the terms 2/10, net 30. Payment on $60,000 sales was received on April 8 and the remaining pay
solve for x in the diagram in the pic
What is the definition of suffrage
Which equation is equal to 4a + 2b = 10
a rectangle has an area of 135 square meters and has a width that is 6 meters shorter than its length what is the perimeter of the rectangle​
|x+8| =−3 plz help!! show steps and stuuf