natashaprophete23 natashaprophete23
  • 03-02-2024
  • Mathematics
contestada

In cell E4, create a formula using structured references that multiplies the Salary value in cell C4 by the Raise Percent value in cell D4

Respuesta :

109318
109318 109318
  • 03-02-2024

Answer:

Step-by-step explanation:

To create a formula in cell E4 using structured references to multiply the Salary value in cell C4 by the Raise Percent value in cell D4, you can use the following formula:

Adjust the table name accordingly if it's different. The formula uses the  symbol to refer to the column in the current row within the table.

Answer Link

Otras preguntas

round 7,782 to the nearest hundred
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
What is the primary purpose of the Supremacy Clause?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what rule does static electricity follow
four yardequal Blank feet
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
find the prime factorization 504
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5