romankaycee10
romankaycee10 romankaycee10
  • 03-02-2024
  • Mathematics
contestada

what percent of 620 is 372

Respuesta :

8031503 8031503
  • 03-02-2024

Answer:

60%

372 is 60% of 620

Step-by-step explanation: Solution for 372 is what percent of 620: 372: 620*100 = (372*100): 620 = 37200: 620 = 60. Now we have: 372 is what percent of 620 = 60.

Answer Link

Otras preguntas

A fitness contract is a/an A. evaluation of strength, flexibility, endurance, and proper nutrition. B. written document stating an individual's
True or false? physical factors affecting community health include geography, community size, and industrial development.
6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
stuck i need help please
The the flourishing of a vibrant black culture in the 1920s in new york city, called _____, was inspired by countee cullen, langston hughes, and claude mckay.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1
What is the pianist and the weary blues doing when he makes the piano moan with Melody
Need Help Fast 33 points please Factor x2 + 10x – 18.