arianna38 arianna38
  • 02-05-2017
  • Mathematics
contestada

Does 8 belong to the solution set of 3x-5>20

Respuesta :

Coyotesfan161 Coyotesfan161
  • 02-05-2017

(3x8)=24) (24-5=19) 19>20  So 8 does not belong because 19 is not greater than 20


Answer Link

Otras preguntas

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15
The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?
What is the solution of the system of equations? y = –2x + 8 y = x – 4
An important change in the american family in the nineteenth century was
Which phrase states a principle that was part of president woodrow wilson's fourteen points?
PLEASE HELP ME ASAP Identify the area of the polygon with vertices P (1, 2), Q (1, 4), R (−1, 6), and S (−3, 2).
Lisa creates a scatter plot of the number of minutes she runs on the treadmill and the calories she burns. About how many more calories does she burn for every
As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D
Which tortoises, mainland or island, need to eat more food per gram of their body mass?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat