gonzaleznaruto3 gonzaleznaruto3

01-06-2021
Biology

contestada

How is cytokinesis different
in plants and animals?

Respuesta :

Honeymoon10 Honeymoon10

01-06-2021

Answer:

Animal cells have a cleavage furrow which will pinch the cytoplasm into two nearly equal parts. While plant cells have a cell plate that forms halfway between the divided nuclei.

Explanation:

Answer Link

Otras preguntas

Identify the specific sensory receptors for each of the five common senses.

What is the French name for the Hall of Mirrors? What is the Avenue Trianon?

(75) pointsPlease help me on these questions ASAP!!!

an integer is one more than four times another. if the product of two integers is 39, then find the integers

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)

NEED HELP PLEASE!!!!!!! The answers for the first arrow is 32, 33.6, 34, 35.4 The second arrow answers are $93.60, $94.20, $96.40, $97.80

Separation of ownership and control creates an agency problem when an agent pursues goals that conflict with the principals' goals. Principals establish and use

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

Which of the following props should you suggest to clients with tight muscles and physical restrictions? A. Pillow and an exercise block B. Exer