pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Factor −1/4 out of −1/2x−5/4y. The factored expression is .
Fysical suo A young girl is on a swing that completes 20.0 cycles in 25 seconds. What are its frequency and period?
What are birth control methods Looking or the meaning no examples also, birth control methods not birth controls.
Which of the following shows an equivalent expression to [(5.3). 12] if only the associative property was used to transform the expression?
Why were Americans in the East and North less eager for war than Americans in the South and West? A) Americans in the South and West relied more on British shi
Bill got 60% off a new jacket. He ended up spending $18. What was the original price of jacket?
Need Help with these problems can so,e some explain and give me the answers.​
please help with question below!
the mass-to charge ratio of the proton is found to be [tex]1.044 \times {10}^{ - 8} kgc[/tex]the charge on the proton is[tex]1.602 \times {10}^{ - 19} c[/tex]ca
Need help with this math problem