hu6zw9hitSayaQ
hu6zw9hitSayaQ hu6zw9hitSayaQ
  • 03-10-2016
  • Mathematics
contestada

What is 35.827 in expanded form?

Respuesta :

adam1542678
adam1542678 adam1542678
  • 06-10-2016
30+5+.8+.02+.007 is 35.827 in expanded form
Answer Link

Otras preguntas

Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels
Which of these sentences is punctuated correctly? Although the concert doesn't start for over an hour; most of the fans have already arrived at the concert hal
The_____ form acidic compounds with hydrogen.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
2. For centuries, Africans enslaved other Africans. Name the two later slave trades that transported millions of Africans to distant lands to work.
31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr
What is the slope of the line that contains the points (10,-3) and (8,-9)?
"which band was led by guitarist peter buck and vocalist michael stipe?"
How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?
how did white supremacists provide support for the ku klux klan