Favela29 Favela29
  • 03-12-2019
  • Mathematics
contestada

what time is 7 1/2 hours before 2:12 a.m.​

Respuesta :

isabellabelo72 isabellabelo72
  • 03-12-2019

Answer: 6:42 pm

Step-by-step explanation:

Answer Link
lillrv lillrv
  • 03-12-2019
It is 6:42 because you count backwards from 2:12 and you go back like a clock and you get 6:42
Answer Link

Otras preguntas

How did southern slaveholders claim that the North benefited from slavery? 1. They demonstrated that slavery was the foundation of the entire American economy.
CAN SOMEONE HELP ME WITH THIS PLEASE ??
Which state ratified the constitution after congress agreed to amend the constitution to include the bill of rights
If XY=18, YZ=14, and XZ=20, find the radius of each circle.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Identify the specific sensory receptors for each of the five common senses.
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
What is the requirement when ratifying a proposed amendment to the United States Constitution? A. approval of three quarters of states in a state convention B.
Please help ASAP!!!!!!!!!!!!!
A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?