RIRI13
RIRI13 RIRI13
  • 03-05-2016
  • Mathematics
contestada

Expand the linear expression: 3(4x+3)

Expand the linear expression 34x3 class=

Respuesta :

Аноним Аноним
  • 03-05-2016
Simple,

3(4x+3)

Distribute the 3...

3*4x=12x
and
3*3=9

Thus, your answer, 12x+9.
Answer Link
200640sydney 200640sydney
  • 03-05-2016
12x+9 that is your answer

Answer Link

Otras preguntas

A guaranteed protection against vague laws is known as which of the following?
World war 2 officially began with hostilities between what two nations A. Japan and the United States B. Germany and Poland C. Japan and China D. Germany an
Name the five transport mechanisms of the cell:
help quick please!! Thanks
Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36
Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.
A man has blood type AB and his wife has blood type B. What are the possible blood types for their child
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new
Under the articles of confederation, political power and authority ultimately rested with the ________.