pay59 pay59
  • 03-12-2018
  • Mathematics
contestada

Convert 87.5 to a fraction and decimal

Respuesta :

nasia80
nasia80 nasia80
  • 04-12-2018
As a faction it is 7/8 and the decimal is 87.5
Answer Link
jayson223 jayson223
  • 04-12-2018

Answer: well first this is already a decimal 87.5 but 87.5 converted into a fraction is 175/2


Answer Link

Otras preguntas

How has water influenced the development of civilization in Africa
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
why is the square root of a perfect square always rational
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How has water influenced the development of civilization in Africa
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Why did the American public mostly oppose joining the League of Nations after WWI?